Nsent) were maintained at a logarithmic growth phase in 1640 RPMI supplemented with 10 fetal calf serum, 2 mM glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 12.5 mg/ml nystatin and 2.5 mg/ml Amphotericin B at 37uC in humidified atmosphere of 5 CO2.CaM KMT Polyclonal Antibody ProductionCaM KMT polyclonal antibodies were generated by immunizing two New Zealand white rabbits with GST-CaM KMT fusion protein. Subcutaneous injection of 1 ml of antigen solution containing approximately 100 mg of the purified recombinant proteins, using Freund’s complete adjuvant were done for the initial immunization. The antigens were injected as native and 35013-72-0 chemical information denatured proteins to produce antibodies that would be useful for Western and immunoprecipitation experiments. Rabbit serum was collected before immunization as a negative control. Three boosts were given with intervals of 3 to 5 weeks, using Freund’s incomplete adjuvant. Serum was collected 1 week after the last injection. All blood samples were refrigerated for 16 h and centrifuged (450 6 g; 10 min) at room temperature. The serum was introduced to further purification [10] and stored at 280uC.ConstructsPreparation of mammalian expression vectors for CaM KMT with C-terminal GFP tag: GFP-CaM KMTsh mammalian expression vector was constructed by PCR amplification using pDNR-LIB-CaM KMTsh as a template and the following forward and reverse primers: 59CGGAATTCA AATGGAGTCGCGAGTCG39; 59ACGCGTCGACCATTTTCCCCTGGTTGCTT39 subcloned into the EcoRI and 1379592 SalI sites of pEGFPN1 plasmid (Clontech). The GFP-CaM KMT full length variant was subcloned into the XhoI and EcoRI of pEGFPN1 plasmid (Clontech) by PCR amplification using pGEX-5X-1-CaM KMT construct as a template and the primers: forward-59CTCGAGATGGAGTCGCGAGTCG39, reverse59GAATTCGCTTTC Title Loaded From File CATGTTTGGTC39. Preparation of mammalian expression vector for CaM KMT with N-terminal Myc-tag: The CaM KMT was amplified by PCR using FLAGCaM KMT construct as a template, with the primers: forward59TTAGAATTCAT GGAGTCGCGAGTCGCG39, reverse59TTACTCGAGCTATCCATGTT TGGTCAAAAT39. The PCR product was subcloned into the EcoRI and XhoI sites of pCan expression plasmid. Cloning of the CaM KMT into bacterial expression vector pGEX-5X-1 with N-terminal GSTRNA Isolation and cDNA PreparationTotal RNA was isolated from lymphoblastoid cells using the EZ-RNA Total RNA Isolation Kit (Biological Industries). Total human RNA of different tissues was purchased from Clontech. Reverse transcription was done using Reverse-iT 1st Strand Synthesis kit (ABgene). The quality of the resulting cDNA has been tested by the amplification of tubulin chaperone E gene with the primers: forward-59AAAACGTCCATGTTCCCATC39; reverse-59CCCCAGACACGATAAGCAGT39.Characterization of CaM KMTRT-PCRRT-PCR was performed on 1? ml of cDNA, 0.5 mM of each primer, 2.5 mM dNTP’s, Taq DNA polymerase (Fermentas). Primer in exon 11: 59ATAAG CAGAAGCGGGTAATGA39, primer in the new found exon: 59GCCTCAAACTCCTGAACTGC39, primer in exon 4 of the long isoform: 59GCAACCATGAGCCCAGCCAAGC39.formaldehyde crosslinking were boiled for 40 minutes, before they were separated by SDS-PAGE.Immunoprecipitation, Western Blot Analysis and Coomassie Staining of SDS-PAGEFor immunoprecipitation, samples of 0.5? mg protein from formaldehyde cross linked lysates were incubated with appropriate amount of antibodies or with unrelated IgG antibody as a negative control, for 1 hour at 4uC. Then 20 ml protein A/G agarose beads (Santa Cruz) were added to each sample an.Nsent) were maintained at a logarithmic growth phase in 1640 RPMI supplemented with 10 fetal calf serum, 2 mM glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 12.5 mg/ml nystatin and 2.5 mg/ml Amphotericin B at 37uC in humidified atmosphere of 5 CO2.CaM KMT Polyclonal Antibody ProductionCaM KMT polyclonal antibodies were generated by immunizing two New Zealand white rabbits with GST-CaM KMT fusion protein. Subcutaneous injection of 1 ml of antigen solution containing approximately 100 mg of the purified recombinant proteins, using Freund’s complete adjuvant were done for the initial immunization. The antigens were injected as native and denatured proteins to produce antibodies that would be useful for Western and immunoprecipitation experiments. Rabbit serum was collected before immunization as a negative control. Three boosts were given with intervals of 3 to 5 weeks, using Freund’s incomplete adjuvant. Serum was collected 1 week after the last injection. All blood samples were refrigerated for 16 h and centrifuged (450 6 g; 10 min) at room temperature. The serum was introduced to further purification [10] and stored at 280uC.ConstructsPreparation of mammalian expression vectors for CaM KMT with C-terminal GFP tag: GFP-CaM KMTsh mammalian expression vector was constructed by PCR amplification using pDNR-LIB-CaM KMTsh as a template and the following forward and reverse primers: 59CGGAATTCA AATGGAGTCGCGAGTCG39; 59ACGCGTCGACCATTTTCCCCTGGTTGCTT39 subcloned into the EcoRI and 1379592 SalI sites of pEGFPN1 plasmid (Clontech). The GFP-CaM KMT full length variant was subcloned into the XhoI and EcoRI of pEGFPN1 plasmid (Clontech) by PCR amplification using pGEX-5X-1-CaM KMT construct as a template and the primers: forward-59CTCGAGATGGAGTCGCGAGTCG39, reverse59GAATTCGCTTTC CATGTTTGGTC39. Preparation of mammalian expression vector for CaM KMT with N-terminal Myc-tag: The CaM KMT was amplified by PCR using FLAGCaM KMT construct as a template, with the primers: forward59TTAGAATTCAT GGAGTCGCGAGTCGCG39, reverse59TTACTCGAGCTATCCATGTT TGGTCAAAAT39. The PCR product was subcloned into the EcoRI and XhoI sites of pCan expression plasmid. Cloning of the CaM KMT into bacterial expression vector pGEX-5X-1 with N-terminal GSTRNA Isolation and cDNA PreparationTotal RNA was isolated from lymphoblastoid cells using the EZ-RNA Total RNA Isolation Kit (Biological Industries). Total human RNA of different tissues was purchased from Clontech. Reverse transcription was done using Reverse-iT 1st Strand Synthesis kit (ABgene). The quality of the resulting cDNA has been tested by the amplification of tubulin chaperone E gene with the primers: forward-59AAAACGTCCATGTTCCCATC39; reverse-59CCCCAGACACGATAAGCAGT39.Characterization of CaM KMTRT-PCRRT-PCR was performed on 1? ml of cDNA, 0.5 mM of each primer, 2.5 mM dNTP’s, Taq DNA polymerase (Fermentas). Primer in exon 11: 59ATAAG CAGAAGCGGGTAATGA39, primer in the new found exon: 59GCCTCAAACTCCTGAACTGC39, primer in exon 4 of the long isoform: 59GCAACCATGAGCCCAGCCAAGC39.formaldehyde crosslinking were boiled for 40 minutes, before they were separated by SDS-PAGE.Immunoprecipitation, Western Blot Analysis and Coomassie Staining of SDS-PAGEFor immunoprecipitation, samples of 0.5? mg protein from formaldehyde cross linked lysates were incubated with appropriate amount of antibodies or with unrelated IgG antibody as a negative control, for 1 hour at 4uC. Then 20 ml protein A/G agarose beads (Santa Cruz) were added to each sample an.
