D expressed as nmol reduced DCIP/ min/mg prot; MRCC III (ubiquinol: cytochrome c (Cyt c) reductase) activity was measured following the reduction of Cyt c at 550 nm and expressed as nmol reduced Cyt c /min/mg prot, and MRCC IV (Cyt c oxidase) activity was measured following the oxidation of Cyt c at 550 nm and expressed as nmol oxidized Cyt c/min/mg prot. All measurements were performed at least three times.Real-time quantitative PCRSuperoxide anion production was assessed by dihydroethidium (DHE) staining. The cells were cultured and treated as above. After rinsed twice with phosphate buffered saline (PBS), the cells were incubated in the dark with 5 M DHE (Sigma-Aldrich, St Louis, MO) for 30 min. In the presence of superoxide anion, DHE can be oxidized to ethidium bromide (EtBr) (Ex 488 nm and Em 610 nm) which expressing red fluorescence. Thus the amount of EtBr is well correlated to the level of cellular superoxide anion. Superoxide anion in the cellsTotal RNA was extracted from L-02 hepatocytes treated with different concentrations of Cr (VI) using the RNeasy Mini Kit (QIAGEN, Hilden, Germany). Then the total RNA (5 g) from each treatment group was reverse-transcribed by the PrimeScript RT reagents kit (Takara, Dalian, China) according to the standard protocol. cDNAs PubMed ID:https://www.ncbi.nlm.nih.gov/pubmed/26024392 were analyzed immediately for Real-time PCR assay using SYBR remix TaqTM (Takara, Dalian, China) with Applied Biosystems 7900HT Fast Real-Time PCR System (Applied Biosystems, Inc., Foster City, CA, USA) to observe the mRNA levels of targeted genes. The primerZhong et al. Journal of Occupational Medicine and Toxicology (2017) 12:Page 4 ofsequence of MRCC I [NADH dehydrogenase [ubiquinone] iron-sulfur protein 3 (NDUFS3)]: 5- atgttgcc caaactggtctc -3 (forward primer), 5- tcactgccttcccagagagt -3 (reverse primer).Measurement of GSH, SOD, Trx, MDA cellular levels and protein levelshematoxylin and eosin (H E). The specimens were then examined under light microscopy.Measurement of Cr contentThe assessments of the GSH, SOD, and malondialdehyde (MDA) levels were conducted by using the standard kits (Jiancheng Bioengineering Institute, Nanjing, China). And the examination of thioredoxin (Trx) level was also using the kit (Huamei Bioengineering Institute, Wuhan, China). GSH level was examined by the amount of total non-protein sulfhydryl groups, SOD level was examined based on the inhibitory effect of SOD on nitro blue tetrazolium (NBT), Trx level was examined by a double antibody sandwich ELISA method, and MDA level was examined by thiobarbituric acid reactive substances (TBARS). Protein levels were determined by Western Blotting. Cell lysate was prepared by lysing the cells and then the protein was electrophoretically transferred onto polyvinylidene difluoride (PVDF) membranes and immunoblotted with the antibodies GSH-1 (H-41) (sc-292,189), SOD-1 Antibody (FL-154) (sc-11,407), and Trx (FL-105) (sc-20,146) (Santa Cruz Biotechnology, USA). After incubated with second antibodies, the membranes were developed with the detection system and exposed to films.Measurement for cell MS023 supplier survival rateThe chromium contents of the samples were determined using the flame atomic absorption spectrometry (F-AAS) method as described earlier [11]. Briefly, prepare chromium standard solution (10 g/l) and add with 1 spectra pure HNO3. Then determine the absorbance of different concentrations of standard chromium solution (0, 0.2, 0.5, 1.0, 2.0, 4.0 g/l) and draw the standard curve. Cr contents of stool,.
